Quick Order

Human SETD7 / SET7 / 9 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SETD7 cDNA Clone Product Information
Gene_bank_ref_id:NM_030648.2
RefSeq ORF Size:1101bp
cDNA Description:Full length Clone DNA of Homo sapiens SET domain containing (lysine methyltransferase) 7 with N terminal His tag.
Gene Synonym:KMT7, SET7, SET9, SET7/9, FLJ21193, KIAA1717, SETD7
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Histone-lysine N-methyltransferase SETD7, also known as SET domain containing (lysine methyltransferase) 7, SET7/9, Histone H3-K4 methyltransferase SETD7, H3-K4-HMTase SETD7, and SETD7, is a member of the histone-lysine methyltransferase family and SET7 subfamily. SETD7 is widely expressed and expressed in pancreatic islets. SETD7 contains three MORN repeats and one SET domain. SETD7 plays a central role in the transcriptional activation of genes such as collagenase or insulin. As a protein lysine methyltransferase (PKMT), SETD7 also has methyltransferase activity toward non-histone proteins such as p53/TP53, TAF10, and possibly TAF7 by recognizing and binding in substrate proteins. The mono-methyltransferase activity of SETD7 is achieved by disrupting the formation at near-attack conformations for the dimethylation reaction. SETD7 is also a novel coactivator of NF-kappaB and plays a role in inflammation and diabetes.

References
  • Wang, H. et al., 2002, Mol Cell 8 (6): 1207-17. 
  • Jacobs, SA. et al., 2002, Nat. Struct. Biol. 9 (11): 833-8. 
  • Xiao B, et al., 2003, Nature. 421 (6923): 652-6.
  • Martens, JH. et al., 2003, Mol. Cell. Biol. 23: 1808-1816.
  • Couture, JF. et al., 2006, Nat Struct Mol Biol  13 (2): 140-6.
  • Size / Price
    Catalog: HG11209-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"