Quick Order

Human CEBPG Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CEBPGcDNA Clone Product Information
Gene_bank_ref_id:BC007582
cDNA Size:453
cDNA Description:ORF Clone of Homo sapiens CCAAT/enhancer binding protein (C/EBP), gamma DNA.
Gene Synonym:GPE1BP, IG/EBP-1
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

CEBPG, also known as CEBP gamma, is a transcription factor which belongs to the CEBP family. Members of this family regulate viral and cellular CCAAT/enhancer element-mediated transcription. CEBP proteins contain the bZIP region, which is characterized by two motifs in the C-terminal half of the protein: a basic region involved in DNA binding and a leucine zipper motif involved in dimerization. CEBPG binds to the enhancer element PRE-I of the IL-4 gene. It Might change the DNA-binding specificity of other transcription factors and recruit them to unusual DNA sites.

References
  • Thomassin H. et al., 1992, Nucleic Acids Res. 20 (12): 3091-8.
  • Nishizawa M. et al., 1992, FEBS Lett. 299 (1): 36-8.
  • Williams SC. et al., 1991, Genes Dev. 5 (9): 1553-67.
  • Melchionna R. et al., 2012, J Invest Dermatol. 132 (7): 1908-17.
  • Size / Price
    Catalog:HG14925-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"