After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GNS / G6S Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GNScDNA Clone Product Information
cDNA Size:1659
cDNA Description:ORF Clone of Homo sapiens glucosamine (N-acetyl)-6-sulfatase DNA.
Gene Synonym:G6S, MGC21274
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human GNS / G6S Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Related Products
Product nameProduct name

Glucosamine (N-acetyl)-6-sulfatase (GNS), also known as G6S, a hydrolase, which is one of the enzymes involved in heparan sulfate catabolism leading to lysosomal storage. GNS is required for the catabolism of the glycosaminoglycans (GAG) including heparin, heparan sulphate, and keratan sulphate through the hydrolysis of 6-sulfate group from the N-acetyl-D-glucosamine 6-sulfate units. Mucopolysaccharidosis type IIID (MPS IIID) is the least common of the four subtypes of Sanfilippo syndrome. It is caused by a deficiency of N-acetylglucosamine-6-sulphatase. A mutation in GNS resulting in MPS IIID indicates the potential utility of molecular diagnosis for this rare condition. As the least common type of the four subtypes of Sanfilippo syndrome, MPS IIID has profound mental deterioration, hyperactivity, and relatively mild somatic manifestations.

  • Fuchs W, et al. (1985) Intralysosomal formation and metabolic fate of N-acetylglucosamine 6-sulfate from keratan sulfate. Eur J Biochem. 151(3): 551-6.
  • Beesley CE, et al. (2003) Sanfilippo syndrome type D: identification of the first mutation in the N-acetylglucosamine-6-sulphatase gene. J Med Genet. 40(3): 192-4.
  • Mok A, et al. (2003) Genomic basis of mucopolysaccharidosis type IIID (MIM 252940) revealed by sequencing of GNS encoding N-acetylglucosamine-6-sulfatase. Genomics. 81(1): 1-5.
  • Elioglu NH, et al. (2009) A novel loss-of-function mutation in the GNS gene causes Sanfilippo syndrome type D. Genet Couns. 20(2): 133-9.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items