Quick Order

Human FDPS Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FDPScDNA Clone Product Information
cDNA Size:1260
cDNA Description:ORF Clone of Homo sapiens farnesyl diphosphate synthase  DNA.
Gene Synonym:FPS, FPPS, FDPS
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Z-farnesyl diphosphate synthase (FDPS) is an enzyme belonging to the family of transferases, specifically those transferring aryl or alkyl groups other than methyl groups. Z-farnesyl diphosphate synthase (FDPS) functions as key enzyme in isoprenoid biosynthesis which catalyzes the formation of farnesyl diphosphate, a precurcor for several classes of essential metabolites. FDPS catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Functions of FDPS may be inactivated by interferon-induced RSAD2. This inactivation may result of disruption of lipid rafts at the plasma membrane, and thus have an antiviral effect since many enveloped viruses need lipid rafts to bud efficiently out of the cell.

  • Pjetursson BE, et al. (2007) Comparison of survival and complication rates of tooth-supported fixed dental prostheses (FDPs) and implant-supported FDPs and single crowns (SCs). Clin Oral Implants Res. 3:97-113.
  • Eschbach S, et al. (2009) Clinical evaluation of all-ceramic posterior three-unit FDPs made of In-Ceram Zirconia. Int J Prosthodont. 22(5):490-2.
  • Moshage HJ, et al. (1990) Differential effects of endotoxin and fibrinogen degradation products (FDPS) on liver synthesis of fibrinogen and albumin: evidence for the involvement of a novel monokine in the stimulation of fibrinogen synthesis induced by FDPS. Int J Biochem. 22(12): 1393-400.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items