Quick Order

Human CYB5R1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CYB5R1 cDNA Clone Product Information
Gene_bank_ref_id:BC018732
RefSeq ORF Size:918bp
cDNA Description:Full length Clone DNA of Homo sapiens cytochrome b5 reductase 1 with C terminal His tag.
Gene Synonym:B5R1, B5R.1, NQO3A2, humb5R2, CYB5R1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Troncoso C, et al. (2008) Influence of electron transport proteins on the reactions catalyzed by Fusarium fujikuroi gibberellin monooxygenases. Phytochemistry. 69(3): 672-83.
  • Qian W, et al. (1998) The influence of mutation at Glu44 and Glu56 of cytochrome b5 on the protein's stabilization and interaction between cytochrome c and cytochrome b5. Biochemistry. 37 (40): 14137-50.
  • Zhu H, et al. (2000) Identification of a cytochrome b-type NAD(P)H oxidoreductase ubiquitously expressed in human cells. Proc Natl Acad Sci. 96 (26): 14742-7.
  • Size / Price
    Catalog: HG13227-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"