After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SerpinA5 ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human SERPINA5 cDNA Clone Product Information
NCBI RefSeq:NM_000624.4
RefSeq ORF Size:1221bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 with C terminal HA tag.
Gene Synonym:PCI, PAI3, PROCI, PLANH3
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Serpin A5, also well known as protein C inhibitor (PCI), is a member of the human serpin superfamily consists of at least 35 members. It is synthesized in the liver and has been detected in saliva, cerebral spinal fluid, amniotic fluid, tears and semen. As a potent inhibitor of the protein C anticoagulant pathway at the levels of both zymogen activation and enzyme inhibition, serpinA5 additionally inhibits a variety of serine protease including thrombin, factor Xa, several kallekreins and acrosin, and plays a role in the processes of blood coagulation and fertilization. Serpin A5 also inhibits urinary plasminogen activator (uPA), a mediator of tumor cell invasion, and regulates tumor growth and metastasis by inhibiting angiogenesis. Furthermore, recent studies have identified PCI as a potent and direct inhibitor of activated HGFA (hepatocyte growth factor activator), suggesting a novel function in the regulation of tissue repair and regeneration. Similar to serpins C1 and D1, the thrombin inhibitory activity of serpinA5 is enhanced by heparin.

References
  • Alireza, R. et al., 1995, J. Biol. Chem. 270: 25336-25339.
  • Silverman, G.A. et al., 2001, J. Biol. Chem. 276: 33293-33296.
  • Malleier, J.M. et al., 2007, Blood. 109: 4769-4776.
  • Asanuma, K. et al., 2007, Int. J. Cancer. 121: 955-965.
  • Hayashi, T. et al., 2007, J. Thromb. Haemost. 5: 1477-1485.
  • Size / Price
    Catalog: HG10309-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"