Quick Order

Human PARP3 transcript variant 2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PARP3 cDNA Clone Product Information
Gene_bank_ref_id:NM_005485.4
RefSeq ORF Size:1602bp
cDNA Description:Full length Clone DNA of Homo sapiens poly (ADP-ribose) polymerase family, member 3, transcript variant 2 with N terminal His tag.
Gene Synonym:IRT1, ADPRT3, ADPRTL2, ADPRTL3, PADPRT-3, PARP3
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Loseva O, et al. (2010) PARP-3 is a mono-ADP-ribosylase that activates PARP-1 in the absence of DNA. J Biol Chem. 285(11): 8054-60.
  • Lehtio L, et al. (2009) Structural basis for inhibitor specificity in human poly(ADP-ribose) polymerase-3. J Med Chem. 52(9): 3108-11.
  • Rouleau M, et al. (2009) Assessment of PARP-3 distribution in tissues of cynomolgous monkeys. J Histochem Cytochem. 57(7): 675-85.
  • Rouleau M, et al. (2007) PARP-3 associates with polycomb group bodies and with components of the DNA damage repair machinery. J Cell Biochem. 100(2): 385-401.
  • Augustin A, et al. (2003) PARP-3 localizes preferentially to the daughter centriole and interferes with the G1/S cell cycle progression. J Cell Sci. 116(Pt 8): 1551-62.
  • Size / Price
    Catalog: HG11190-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"