After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NCSTN ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NCSTN cDNA Clone Product Information
Gene_bank_ref_id:NM_015331.2
RefSeq ORF Size:2130bp
cDNA Description:Full length Clone DNA of Homo sapiens nicastrin with N terminal His tag.
Gene Synonym:APH2, KIAA0253, RP11-517F10.1, NCSTN
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Nicastrin (NCST, or NCT), a single-pass membrane glycoprotein that harbors a large extracellular domain, is an essential component of the gamma-secretase complex. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes. Increasing evidences have shown that Nicastrin/NCSTN plays a crucial role in gamma-cleavage of the amyloid precursor protein (APP). The glycoprotein Nicastrin is an essential component of the gamma-secretase complex, a high molecular weight complex which also contains the presenilin proteins, Aph-1 and Pen-2. The gamma-secretase complex is not only involved in APP processing but also in the processing of an increasing number of other type I integral membrane proteins. As the largest subunit of the gamma-secretase complex, Nicastrin plays a crucial role in its activation. Inhibition of NCSTN demonstrated an altered gamma-cleavage activity, suggesting its potential implication in developing Alzheimer's disease (AD). In addition, Nicastrin can function to maintain epithelial to mesenchymal transition during breast cancer progression. Anti-nicastrin polyclonal and monoclonal antibodies were able to decrease notch1 and vimentin expression and reduced the invasive capacity of breast cancer cells in vitro.

References
  • He G, et al. (2007) Degradation of nicastrin involves both proteasome and lysosome. J Neurochem. 101(4): 982-92.
  • Hayashi I, et al. (2009) Single chain variable fragment against nicastrin inhibits the gamma-secretase activity. J Biol Chem. 284(41): 27838-47.
  • Ma Z, et al. (2009) Association between promoter polymorphisms of the nicastrin gene and sporadic Alzheimer's disease in North Chinese Han population. Neurosci Lett. 458(3): 136-9.
  • Pardossi-Piquard R, et al. (2009) p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex. J Neurochem. 109(1): 225-37.
  • Filipovi? A, et al. (2011) Biological and clinical implications of nicastrin expression in invasive breast cancer. Breast Cancer Res Treat. 125(1): 43-53.
  • Size / Price
    Catalog: HG11183-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"