Quick Order

Human OSF2 / POSTN transcript variant 4 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human POSTN cDNA Clone Product Information
Gene_bank_ref_id:NM_001135936.1
RefSeq ORF Size:2256bp
cDNA Description:Full length Clone DNA of Homo sapiens periostin, osteoblast specific factor, transcript variant 4 with C terminal HA tag.
Gene Synonym:Pn, OSF-2, PDLPOSTN, MGC119510, MGC119511, periostin, RP11-412K4.1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Periostin ( POSTN ), also known as OSF2 (osteoblast specific factor 2), is a heterofunctional secreted extracellular matrix (ECM) protein comprised of four fasciclin domains that promotes cellular adhesion and movement, as well as collagen fibrillogenesis. Postn is expressed in unique growth centers during embryonic development where it facilitates epithelial-mesenchymal transition (EMT) of select cell populations undergoing reorganization. In the adult, Postn expression is specifically induced in areas of tissue injury or areas with ongoing cellular re-organization. In the adult heart Postn is induced in the ventricles following myocardial infarction, pressure overload stimulation, or generalized cardiomyopathy. Although the detailed function of Postn is still unclear, Postn-integrin interaction is thought to be involved in tumor development. Postn is frequently overexpressed in various types of human cancers, stimulating metastatic growth by promoting cancer cell survival, invasion and angiogenesis, and can be a useful marker to predict the behavior of cancer.

References
  • Kudo,Y. et al., 2007, Histol Histopathol. 22 (10):1167-1174.
  • Li, J.S. et al., 2007, World J Gastroenterol. 13 (39): 5261-5266.
  • Oku, E. et al., 2008, Int J Hematol. 88 (1): 57-63.
  • Hamilton, D.W. et al., 2008, J Cell Commun Signal. 2(1-2):9-17.
  • Puglisi, F.J et al., 2008, Clin Pathol. 61 (4): 494-498.
  • Conway, S. J. et al., 2008, Curr Genomics. 9 (8): 548-555.
  • Size / Price
    Catalog: HG10299-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"