After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Influenza A H1N1 (A/Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H1N1 HA cDNA Clone Product Information
RefSeq ORF Size:1701bp
cDNA Description:Full length Clone DNA of Influenza A H1N1 (A/A/Beijing/22808/2009) Hemagglutinin with Myc-tag.
Gene Synonym:Hemagglutinin, HA
Restriction Site:KpnI + XhoI (5.4kb + 1.75kb)
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ADD64203.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-Myc Vector Information
Vector Name pCMV2-Myc
Vector Size 5598bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Influenza A H1N1 (A/Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, Myc tag on other vectors
Influenza A H1N1 (A/Beijing/22808/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40035-ACG$345
Influenza A H1N1 (A/Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40035-ACR$345
Influenza A H1N1 (A/Beijing/22808/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40035-C$395
Influenza A H1N1 (A/Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, Myc tagVG40035-C-M$395
Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40035-CF$315
Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40035-CH$315
Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40035-CM$315
Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40035-CY$315
Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40035-NF$315
Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40035-NH$315
Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40035-NM$315
Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40035-NY$315
Influenza A H1N1 (Beijing/22808/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40035-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40035-C-M
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions