Quick Order

Text Size:AAA

Cynomolgus monkey KLRK1 / NKG2D ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus KLRK1 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:651bp
cDNA Description:Full length Clone DNA of Macaca mulatta NKG2D protein with N terminal HA tag.
Gene Synonym:KLRK1, NKG2-D, NKG2D
Species:Cynomolgus
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

NKG2D, also known as CD314, is an immune receptor which consists of two disulphide-linked type II transmembrane proteins with short intracellular proteins uncapable to transduce signals. In order to transduce signals, NKG2D needs adaptor proteins and it uses two adaptor proteins, DAP10 and DAP12. These two adaptor proteins associate as homodimers to NKG2D- therefore the entire receptor complex appears as a hexamer. NKG2D can send co-stimulatory signals to activate CD8 T cells. NKG2D also plays an important role in viral control. Cellular stress can induce ligands for NKG2D which results in the cell susceptible to NK cell-mediated lysis.

References
  • Houchins J, et al. (1991) DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. J Exp Med. 173: 1017-102.
  • Bauer S, et al. (1999) Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science. 285(5428):727-9.
  • Zafirova B, et al. (2011) Regulation of immune cell function and differentiation by the NKG2D receptor. Cell Mol Life Sci. 68(21):3519-29.
  • Size / Price
    Catalog: CG90164-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"