After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ANXA6 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ANXA6 cDNA Clone Product Information
NCBI RefSeq:NM_001155.3
RefSeq ORF Size:2022bp
cDNA Description:Full length Clone DNA of Homo sapiens annexin A6 with N terminal His tag.
Gene Synonym:ANX6, CBP68, ANXA6
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Annexin A6, also known as ANXA6 or ANXAⅥ, belongs to a family of Ca2+-dependent membrane and phospholipid binding proteins. Members of this family have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 6 is phosphorylated in vivo associated with cell growth. Annexin 6 was not phosphorylated in quiescent cells, but was phosphorylated on serine and to a lesser extent threonine, several hours following cell stimulation. Experiment has revealed the presence of annexin A6 on the cell surface of variety cells as putative receptors and / or binding proteins for chondroitin sulfate proteoglycans, helping cells to bind with this extracellular matrix glycosaminoglycan chondroitin sulfate which is related to the cell-substratum adhesion. A post-tranlational modification other than direct protein phosphorylation may influence the activity of annexin6 and provide evidence linking cell growth with regulation of annexin 6 function. 

References
  • Takagi H, et al. (2002) Annexin 6 is a putative cell surface receptor for chondroitin sulfate chains. J Cell Sci. 115 (16): 3309-18.
  • Moss SE, et al. (1992) A growth-dependent post-translational modification of annexin VI. Biochim Biophys Acta. 1160 (1): 120-6.
  • Song G, et al. (1998) Altered cardiac annexin mRNA and protein levels in the left ventricle of patients with end-stage heart failure. J Mol Cell Cardio. 30 (3): 443-51.
  • Size / Price
    Catalog: HG11161-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"