Quick Order

Human MKI67 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MKI67 cDNA Clone Product Information
Gene_bank_ref_id:NM_002417.4
RefSeq ORF Size:819bp
cDNA Description:Full length Clone DNA of Homo sapiens antigen identified by monoclonal antibody Ki-67 with C terminal His tag.
Gene Synonym:KIA, MKI67
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

MKI67 contains 1 FHA domain and plays a key role in cell proliferation. During interphase, the MKI67 antigen can be exclusively detected within the cell nucleus, whereas in mitosis most of the protein is relocated to the surface of the chromosomes. MKI67 protein is present during all active phases of the cell cycle (G1, S, G2, and mitosis), but is absent from resting cells. MKI67 is an excellent marker to determine the growth fraction of a given cell population. The fraction of MKI67-positive tumor cells is often correlated with the clinical course of cancer. It is also associated with ribosomal RNA transcription. Inactivation of antigen MKI67 leads to inhibition of ribosomal RNA synthesis.

The MKI67 protein is a nuclear and nucleolar protein, which is tightly associated with somatic cell proliferation. Antibodies raised against the human MKI67 protein paved the way for the immunohistological assessment of cell proliferation, particularly useful in numerous studies on the prognostic value of cell growth in clinical samples of human neoplasms. MKI67 protein expression is an absolute requirement for progression through the cell-division cycle. Recently, MKI67 is proved be an independent prognostic factor for disease-free survival (HR 1.05-1.72) in multivariate analyses studies using samples from randomized clinical trials with secondary central analysis of the biomarker. MKI67 was not found to be predictive for long-term follow-up after chemotherapy. Nevertheless, high KI-67 was found to be associated with immediate pathological complete response in the neoadjuvant setting, with an LOE of II-B. MKI67 could be considered as a prognostic biomarker for therapeutic decision.

References
  • Rahmanzadeh R, et al. (2007) Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis. Cell Prolif. 40(3):422-30.
  • Bullwinkel J, et al. (2006) Ki-67 protein is associated with ribosomal RNA transcription in quiescent and proliferating cells. J Cell Physiol. 206(3):624-35.
  • Schonk DM, et al. (1989) Assignment of the gene(s) involved in the expression of the proliferation-related Ki-67 antigen to human chromosome 10. Hum Genet. 83(3):297-9.
  • Endl E, et al., 2000, Exp Cell Res. Jun 15;257(2): 231-7.
  • Luporsi E, et al., 2012, Breast Cancer Res Treat. 132(3): 895-915.
  • Scholzen T, et al., 2000, J Cell Physiol. 182(3): 311-22.
  • Size / Price
    Catalog: HG13180-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"