Quick Order

Human LTA4H ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LTA4H cDNA Clone Product Information
NCBI RefSeq:NM_000895.2
RefSeq ORF Size:1836bp
cDNA Description:Full length Clone DNA of Homo sapiens leukotriene A4 hydrolase with C terminal HA tag.
Gene Synonym:LTA4H
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Mouse leukotriene A-4 hydrolase, also known as LTA-4 hydrolase, Leukotriene A (4) hydrolase, LTA4H and LTA4, is cytoplasm protein which belongs to the peptidase M1 family. LTA4H hydrolyzes an epoxide moiety of leukotriene A4 (LTA-4) to form leukotriene B4 (LTB-4). This enzyme also has some peptidase activity. The leukotrienes (LTs) are a class of structurally related lipid mediators involved in the development and maintenance of inflammatory and allergic reactions. In the biosynthesis of LTs, arachidonic acid was converted into the unstable intermediate epoxide LTA4, which may in turn be conjugated with glutathione to form the spasmogenic LTC4, or hydrolyzed into the proinflammatory lipid mediator LTB4 in a reaction catalyzed by Leukotriene A4 hydrolase (LTA4H). LTB4 is a classical chemoattractant of human neutrophils and triggers adherence and aggregation of leukocytes to vascular endothelium, and also modulates immune responses. As a bifunctional zinc metalloenzyme, LTA4H also exhibits an anion-dependant arginyl aminopeptidase activity of high efficiency and specificity in addition to its epoxide hydrolase activity. LTA4H is regarded as a therapeutic target for inflammation.

References
  • Mancini, JA. et al.,1995, Eur. J. Biochem. 231: 65-71.
  • Orning, L. et al., 1994, J. Biol. Chem. 269: 11269-73.
  • Rudberg, PC. et al., 2004, J. Biol. Chem. 279: 27376-82.
  • Qiu, H. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 8161-6.
  • Size / Price
    Catalog: HG10276-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"