Quick Order

Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MDH1cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:1035
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) malate dehydrogenase 1, NAD (soluble) DNA.
Gene Synonym:MDH1
Species:Cynomolgus
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
 
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90156-ACG$325
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90156-ACR$325
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90156-ANG$325
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90156-ANR$325
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90156-CF$295
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90156-CH$295
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90156-CM$295
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90156-CY$295
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone)CG90156-G$95
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90156-NF$295
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90156-NH$295
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90156-NM$295
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90156-NY$295
Cynomolgus monkey MDH1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90156-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Malate dehydrogenases 1(MDH1 / MDHA) is soluable form of malate dehydrogenases. Malate dehydrogenases (MDH) is a group of multimeric enzymes consisting of identical subunits usually organized as either dimer or tetramers with subunit molecular weights of 30-35 kDa. MDH has been isolated from different sources including archaea, eubacteria, fungi, plant and mammals. MDH catalyzes the NAD/NADH-dependent interconversion of the substrates malate and oxaloacetate. This reaction plays a key part in the malate / aspartate shuttle across the mitochondrial membrane, and in the tricarboxylic acid cycle within the mitochondrial matrix. The enzymes share a common catalytic mechanism and their kinetic properties are similar, which demonstrates a high degree of structural similarity. The three-dimensional structures and elements essential for catalysis are conserved between mitochondrial and cytoplasmic forms of MDH in eukaryotic cells even though these isoenzymes are only marginally related at the level of primary structure. 

References
  • Minarik P, et al. (2002) Malate dehydrogenases--structure and function. Gen Physiol Biophys. 21 (3): 257-65.
  • Musrati RA, et al. (1998) Malate dehydrogenase: distribution, function and properties. Gen Physiol Biophys. 17 (3): 193-210.
  • Hall MD, et al. (1992) Crystal structure of Escherichia coli malate dehydrogenase. A complex of the apoenzyme and citrate at 1.87 A resolution. J Mol Biol. 226 (3): 867-82.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"