Quick Order

Human PTPRJ ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PTPRJ cDNA Clone Product Information
Gene_bank_ref_id:NM_002843.3
RefSeq ORF Size:4014bp
cDNA Description:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, receptor type, J with C terminal His tag.
Gene Synonym:DEP1, SCC1, CD148, HPTPeta, R-PTP-ETA, PTPRJ
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

DEP1 / PTPRJ (Receptor-type tyrosine-protein phosphatase eta) is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. DEP1 / PTPRJ possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. DEP1 / PTPRJ is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. In stable MCF-7 cell lines lines, induction of DEP-1 expression inhibited breast cancer cell growth by 5-10-fold. These data describe PTPs expressed and regulated in breast cancer cell lines during differentiation and identify one PTP, DEP-1, that inhibits the growth of breast cancer cells in vitro.

References
  • Holsinger LJ, et al. (2002) The transmembrane receptor protein tyrosine phosphatase DEP1 interacts with p120. Oncogene. 21(46): 7067-76.
  • Huang X, et al. (2009) Natural variation at the DEP1 locus enhances grain yield in rice. Nat Genet. 41(4): 494-7.
  • Kuramochi S, et al. (1996) Molecular cloning and characterization of Byp, a murine receptor-type tyrosine phosphatase similar to human DEP-1. FEBS Lett. 378(1): 7-14.
  • Size / Price
    Catalog: HG13165-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"