Quick Order

Text Size:AAA

Human S100A7 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human S100A7 cDNA Clone Product Information
Gene_bank_ref_id:NM_002963.3
RefSeq ORF Size:306bp
cDNA Description:Full length Clone DNA of Homo sapiens S100 calcium binding protein A7 with N terminal His tag.
Gene Synonym:PSOR1, S100A7c, S100A7
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Protein S100-A7, also known as S100 calcium-binding protein A7, Psoriasin, S100A7, and PSOR1, is a secreted protein which belongs to the S-100 family. S100A7 was first isolated from skin involved by psoriasis, which can be induced in cultured squamous epithelial cells. S100A7 is expressed by both normal cultured and malignant keratinocytes and malignant breast epithelial cells within ductal carcinoma in situ, suggesting an association with abnormal pathways of differentiation. S100A7 plays a role in the pathogenesis of inflammatory skin disease, as a chemotactic factor for hematopoietic cells. It also plays a role in early stages of breast tumor progression in association with the development of the invasive phenotype.

References
  • Miyasaki, KT. et al., 1993, J. Dent. Res. 72: 517-23.
  • Watson, PH. et al., 1998, Int J Biochem Cell Biol  30 (5):567-71.
  • Emberley, ED. et al., 2004, Breast Cancer Res  6 (4): 153-9.
  • Ohuchida, K. et al., 2006, Clin Cancer Res  12 (18):5417-22.
  • Kouno, T. et al., 2008, J Pept Sci. 14 (10):1129-38.
  • León, R. et al., 2009, Biochemistry. 48 (44): 10591-600.
  • Size / Price
    Catalog: HG11141-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"