Quick Order

Text Size:AAA

Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A11cDNA Clone Product Information
cDNA Size:318
cDNA Description:ORF Clone of Homo sapiens S100 calcium binding protein A11 DNA.
Gene Synonym:MLN70, S100C, S100A11
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11140-ACG$325
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11140-ACR$325
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11140-ANG$325
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11140-ANR$325
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11140-CF$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11140-CH$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11140-CM$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11140-CY$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone)HG11140-M$95
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11140-M-F$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11140-NF$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11140-NH$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11140-NM$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11140-NY$295
Human S100A11 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11140-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Protein S100-A11, also known as S100 calcium-binding protein A11, S100A11 and MLN70, is a member of the S-100 family. S100A11 is widely expressed in multiple tissues, and is located in cytoplasm, nucleus, and even cell periphery. S100A11 exists as a non-covalent homodimer with an antiparallel conformation. Ca(2+) binding to S100A11 would trigger conformational changes which would expose the hydrophobic cleft of S100A11 and facilitate its interaction with target proteins. As a dual cell growth mediator, S100A11 acts as either a tumor suppressor or promoter in many different types of tumors and would play respective roles in influencing the proliferation of the cancer cells. In the nucleus, S100A11 suppresses the growth of keratinocytes through p21 (CIP1/WAF1) activation and induces cell differentiation. S100A11 is also a novel diagnostic marker in breast carcinoma.

  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Ohuchida K. et al., 2006, Clin Cancer Res  12 (18): 5417-22.
  • Kouno T. et al., 2008, J Pept Sci. 14 (10): 1129-38.
  • He H. et al., 2009, Cell Biochem Biophys 55 (3): 117-26.
  • Liu XG. et al., 2010, Oncol Rep. 23 (5): 1301-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items