Quick Order

Cynomolgus monkey IFNA4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IFNA4cDNA Clone Product Information
cDNA Size:570
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) interferon, alpha 4 DNA.
Gene Synonym:IFNA4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Interferon & Receptor Related Products
Product nameProduct name
Mouse IFNA2 / Interferon alpha 2 ProteinCynomolgus IFNAR1 / IFNAR ProteinCynomolgus / Rhesus IFNA2 / Interferon alpha 2 ProteinHuman IL29 / IFNL1 ProteinCynomolgus IFNAR2 / IFNABR Protein (ECD, His Tag)Human Interferon alpha 2 / IFNA2 ProteinMouse IL-28B / IFN-lambda-3 Protein (His Tag)Cynomolgus / Rhesus IFNG / Interferon Gamma ProteinHuman IFNα4 / IFNa4 / Interferon alpha-4 Protein (Fc Tag)Human IFNα4 / IFNa4 / Interferon alpha-4 Protein (His Tag)Human IFNGR1 / CD119 Protein (His & Fc Tag)Human IFNGR1 / CD119 Protein (His Tag)Human Interferon alpha 7 / IFNA7 Protein (Fc Tag)Human IFNA5 / IFNaG / Interferon alpha-G Protein (Fc Tag)Human Interferon alpha-B / IFNA8 ProteinHuman Interferon alpha 10 / IFNA10 Protein (Fc Tag)Human Interferon omega-1 / IFNω / IFNW1 Protein (Fc Tag)Human IFN omega 1 / IFNW1 Protein (His Tag)Human IFNAR2 / IFNABR Protein (Fc Tag)Human IFNAR2 / IFNABR Protein (His Tag)Human Interferon beta / IFN-beta / IFNB Protein (Fc Tag)Human Interferon beta / IFN-beta / IFNB ProteinHuman Interferon alpha-B / IFNA8 Protein (His Tag)Human IFN-gamma / IFNG / γ-IFN ProteinHuman IFNL3 / IL28B / Interleukin-28B Protein (His Tag)Human IL-29 / Interleukin-29 Protein (His Tag)Mouse IFNA5 / IFNaG Protein (His Tag)Human IFNAR1 / IFNAR Protein (Fc Tag)Human IFNAR1 / IFNAR Protein (His Tag)Mouse IFNAR1 / IFNAR Protein (His Tag)Mouse IFNA2 / Interferon alpha 2 Protein (Fc Tag)Mouse IFNA5 / IFNaG Protein (Fc Tag)Mouse IFNG / Interferon Gamma ProteinMouse IFNGR2 Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (Fc Tag)Mouse IFNA4 / Interferon alpha-4 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (His Tag)Mouse IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Mouse IFNB1 / IFN-beta / Interferon beta ProteinMouse IFNG / Interferon Gamma Protein (Fc Tag)Mouse IFNG / Interferon Gamma Protein (His Tag)Cynomolgus / Rhesus IFNA14 / Interferon alpha-14 Protein (His Tag)Ferret IFNG / Interferon Gamma Protein (His Tag)Rat IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (His Tag)Rat IFNGR / IFNGR1 Protein (Fc Tag)Rat IFNA5 / IFNaG Protein (His Tag)Rat IFNG / Interferon Gamma Protein (Fc Tag)Cynomolgus IFNA2 / Interferon alpha 2 Protein (Fc Tag)Cynomolgus IFNA2 / Interferon alpha 2 Protein (His Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (Fc Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (His Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (Fc Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (His Tag)Cynomolgus IFNAR1 / IFNAR Protein (His Tag)Cynomolgus IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Cynomolgus IFNGR / IFNGR1 Protein (Fc Tag)Cynomolgus IFNGR / IFNGR1 Protein (His Tag)Cynomolgus IFN gamma Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (His Tag)Cynomolgus IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Cynomolgus IFNAR1 / IFNAR Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (His Tag)Mouse IFNA4 / IFNα4 / Interferon alpha-4 Protein (His Tag)

Interferon, alpha 4 (IFNA4) belongs to the alpha/beta interferon family. Two variants of IFNA4 (IFNA4a and IFNA4b) are known, which differ from each other by changes in their coding regions at nucleotide positions 220 and 410 and can be distinguished by selective restriction enzyme analysis. Interferons are produced by macrophages, IFN-alpha have antiviral activities. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. IFN-alpha, the first cytokine to be produced by recombinant DNA technology, has emerged as an important regulator of growth and differentiation, affecting cellular communication and signal transduction pathways as well as immunological control. Originally discovered as an antiviral substance, the efficacy of IFN-alpha in malignant, viral, immunological, angiogenic, inflammatory, and fibrotic diseases suggests a spectrum of interrelated pathophysiologies. IFN-alpha emerged as a prototypic tumor suppressor protein that represses the clinical tumorigenic phenotype in some malignancies capable of differentiation.

  • Lau JY, et al. (1993) Discrepancy between biochemical and virological responses to interferon-alpha in chronic hepatitis C. Lancet. 342(8881): 1208-9.
  • Kessler DS, et al. (1990) Interferon-alpha regulates nuclear translocation and DNA-binding affinity of ISGF3, a multimeric transcriptional activator. Genes Dev. 4(10): 1753-65.
  • Gutterman JU. Cytokine therapeutics: lessons from interferon alpha. Proc Natl Acad Sci U S A. 91(4): 1198-205.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items