Quick Order

Human SDPR ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SDPR cDNA Clone Product Information
Gene_bank_ref_id:BC016475
RefSeq ORF Size:1278bp
cDNA Description:Full length Clone DNA of Homo sapiens serum deprivation response with N terminal Myc tag.
Gene Synonym:CAVIN2, PS-p68, SDR, cavin-2, SDPR
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Mouse Serum deprivation-response protein, also known as Phosphatidylserine-binding protein, Cavin-2 and SDPR, is a member of the PTRF / SDPR family. SDPR is highly expressed in heart and lung, and expressed at lower levels in brain, kidney, liver, pancreas, placenta, and skeletal muscle. SDPR is a new regulator of caveolae biogenesis. SDPR is up-regulated in asyncronously growing fibroblasts following serum deprivation but not following contact inhibition and Down-regulated during synchronous cell cycle re-entry. Caveolae are plasma membrane invaginations with a characteristic flask-shaped morphology. They function in diverse cellular processes, including endocytosis. Loss of SDPR causes loss of caveolae. SDPR binds directly to PTRF and recruits PTRF to caveolar membranes. Overexpression of SDPR, unlike PTRF, induces deformation of caveolae and extensive tubulation of the plasma membrane. SDPR overexpression results in increased caveolae size and leads to the formation of caveolae-derived tubules containing Shiga toxin. SDPR is a membrane curvature inducing component of caveolae, and that STB-induced membrane tubulation is facilitated by caveolae. Pleckstrin and SDPR are phosphorylated by protein kinase C (PKC), the interaction between pleckstrin and SDPR was shown to be independent of PKC inhibition or activation. SDPR may facilitate the translocation of nonphosphorylated pleckstrin to the plasma membrane in conjunction with phosphoinositides that bind to the C-terminal PH domain.

References
  • Li,X. et al., 2008, Cancer Sci. 99 (7):1326-33.
  • Hansen,C.G. et al., 2009, Nat Cell Biol. 11 (7):807-14.
  • Baig,A. et al., 2009, Platelets. 20 (7):446-57.
  • Nabi,IR. et al., 2009, Nat Cell Biol.11 (7):789-91.
  • Size / Price
    Catalog: HG14090-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"