Quick Order

Text Size:AAA

Cynomolgus monkey IL17RA Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL17RAcDNA Clone Product Information
cDNA Size:2598
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) interleukin 17 receptor A DNA.
Gene Synonym:IL17RA
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

IL-17 Family & Receptor Related Products
Product nameProduct name
Canine IL17 / IL17A ProteinRat IL17RA / IL17R Protein (Fc Tag)Marmoset IL17 / IL17A ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL17 / IL17A ProteinHuman p38 alpha / MAPK14 Protein (Activated in vitro, His Tag)Canine IL-17RD Protein (Fc Tag)Cynomolgus IL17BR / IL17RB / IL-17 Receptor B Protein (ECD, His Tag)Human IL17B / IL-17B Protein (Fc Tag)Rat IL17F / IL-17F Protein (His Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL25 Protein (Fc Tag)Human IL17RD Protein (His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Canine IL17RD Protein (His Tag)Human IL17RA / CD217 Protein (His & Fc Tag)Human IL17RA / CD217 Protein (His Tag)Human IL17 / IL17A Protein (His Tag)Human IL17RC Protein (Fc Tag)Human IL17RC Protein (aa 1-454, His Tag)Mouse IL17F / IL-17F Protein (His Tag)Mouse IL17F / IL-17F ProteinHuman IL-17F / Interleukin-17F Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Human IL17 / IL17A Protein (His Tag)Human IL17 / IL17A ProteinHuman RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Mouse IL17B / IL-17B Protein (Fc Tag)Human IL17RB / IL-17 Receptor B Protein (Flag Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Mouse IL25 Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (Fc Tag)Mouse IL17RA / IL17R / CD217 Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse IL17 / IL17A ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL-17F / IL17F ProteinRat IL17RA / IL17R Protein (His Tag)Rat Interleukin 25 / IL25 / IL17E Protein (Fc Tag)Cynomolgus IL17RA / IL17R Protein (Fc Tag)Mouse IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Human IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)

Interleukin-17 receptor (IL-17R), also known as Interleukin-17 receptor A (IL-17RA) and CD217 antigen (CD217), is a cytokine receptor which binds interleukin 17. IL-17R/IL-17RA (CD217) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. IL-17R/IL-17RA (CD217) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor IL-17RA play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Defects in IL-17R/IL-17RA (CD217) are the cause of familial candidiasis type 5 (CANDF5). CANDF5 is a rare disorder with altered immune responses and impaired clearance of fungal infections, selective against Candida. It is characterized by persistent and/or recurrent infections of the skin, nails and mucous membranes caused by organisms of the genus Candida, mainly Candida albicans.

  • Gaffen SL. (2009) Structure and signalling in the IL-17 receptor family. Nat Rev Immunol. 9 (8): 556-67.
  • Johansen C, et al.. (2009) Characterization of the interleukin-17 isoforms and receptors in lesional psoriatic skin. Br J Dermatol. 160 (2): 319-24.
  • Yao Z, et al.. (1997) Molecular characterization of the human interleukin (IL)-17 receptor. Cytokine 9 (11): 794-800.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items