Quick Order

Text Size:AAA

Human CES3 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CES3 cDNA Clone Product Information
Gene_bank_ref_id:NM_024922.4
RefSeq ORF Size:1716bp
cDNA Description:Full length Clone DNA of Homo sapiens carboxylesterase 3 with N terminal His tag.
Gene Synonym:ES31, FLJ21736, CES3
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Carboxylesterases hydrolyze esters of short-chain fatty acids and have roles in animals ranging from signal transduction to xenobiotic detoxification. In enzymology, a carboxylesterase is an enzyme that catalyzes the chemical reaction: a carboxylic ester + H2O = an alcohol + a carboxylate. Most enzymes from this group belong to the superfamily of hydrolases with alpha/beta protein fold (so called Alpha/beta hydrolase fold), specifically those acting on carboxylic ester bonds. The carboxylesterase family of evolutionarily related proteins (those with clear sequence homology to each other) includes a number of proteins with different substrate specificities, such as acetylcholinesterases. Carboxylesterase 3, also known as Liver carboxylesterase 31 homolog and CES3, is a endoplasmic reticulum lumen which belongs to the type-B carboxylesterase/lipase family. CES3 is involved in the detoxification of xenobiotics and in the activation of ester and amide prodrugs. CES3 shows low catalytic efficiency for hydrolysis of CPT-11, a prodrug for camptothecin used in cancer therapeutics. CES3 is expressed in liver, colon and small intestine.

References
  • Augusteyn RC. et al.,1969, Biochim Biophys Acta. 171 (1): 128-37.
  • Saito S. et al., 2003, J. Hum. Genet. 48: 249-70.
  • Sanghani SP. et al., 2003, Clin Cancer Res. 9: 4983-91.
  • Sanghani SP. et al., 2004, Drug Metab Dispos. 32: 505-11.
  • Chen R. et al., 2009, J Proteome Res. 8: 651-61.
  • Size / Price
    Catalog: HG11129-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"