Quick Order

Human NELL2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NELL2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001145107.1
RefSeq ORF Size:2601bp
cDNA Description:Full length Clone DNA of Homo sapiens NEL-like 2 (chicken) with C terminal His tag.
Gene Synonym:NRP2, NELL2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Kuroda S, et al. (1999) Biochemical characterization and expression analysis of neural thrombospondin-1-like proteins NELL1 and NELL2. Biochem Biophys Res Commun. 265(1): 79-86.
  • Oyasu M, et al. (2000) Immunocytochemical localization of a neuron-specific thrombospondin-1-like protein, NELL2: light and electron microscopic studies in the rat brain. Brain Res Mol Brain Res. 76(1): 151-60.
  • Nelson BR, et al. (2002) Restricted neural epidermal growth factor-like like 2 (NELL2) expression during muscle and neuronal differentiation. Mech Dev. 119 Suppl 1: 11-9.
  • Size / Price
    Catalog: HG13132-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"