After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ALDH3A1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ALDH3A1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001135168.1
RefSeq ORF Size:1362bp
cDNA Description:Full length Clone DNA of Homo sapiens aldehyde dehydrogenase 3 family, member A1 with C terminal His tag.
Gene Synonym:ALDH3, ALDHIII, MGC10406, ALDH3A1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Pappa A, et al. (2003) Human aldehyde dehydrogenase 3A1 (ALDH3A1): biochemical characterization and immunohistochemical localization in the cornea. Biochem J. 376(3): 615-23.
  • Estey T, et al. (2007) ALDH3A1: a corneal crystallin with diverse functions. Experimental Eye Research. 84(1):3-12.
  • Pappa A, et al. (2003) Aldh3a1 protects human corneal epithelial cells from ultraviolet- and 4-hydroxy-2-nonenal-induced oxidative damage. Free Radical Biology and Medicine. 34(9):1178-89.
  • Size / Price
    Catalog: HG13129-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"