Quick Order

Text Size:AAA

Human TFAP2C ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TFAP2C cDNA Clone Product Information
Gene_bank_ref_id:NM_003222.3
RefSeq ORF Size:1353bp
cDNA Description:Full length Clone DNA of Homo sapiens transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) with C terminal His tag.
Gene Synonym:ERF1, TFAP2G, hAP-2g, AP2-GAMMA, TFAP2C
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

TFAP2C, also known as AP2-GAMMA, is a member of the activating protein 2 family of transcription factors. AP-2 factors bind to the consensus sequence 5'-GCCNNNGGC-3' and activate genes involved in a large spectrum of important biological functions including proper eye, face, body wall, limb and neural tube development. They also suppress a number of genes including MCAM/MUC18, C/EBP alpha and MYC. TFAP2C may be prognostic indicators for patients with breast tumors. TFAP2C gene has been tested for association to diseases (Breast Neoplasms; Carcinoma) and proposed to participate in processes (cell-cell signaling, male gonad development, regulation of transcription from RNA polymerase II promoter). Proteins are expected to have molecular functions (DNA binding, protein binding, protein dimerization activity, transcription factor activity) and to localize in various compartments (membrane, nucleus).

References
  • Woodfield GW, et al. (2009) Interaction of TFAP2C with the estrogen receptor-alpha promoter is controlled by chromatin structure. Clin Cancer Res. 15 (11): 3672-9.
  • Zhao C, et al. (2003) Elevated expression levels of NCOA3, TOP1, and TFAP2C in breast tumors as predictors of poor prognosis. Cancer. 98 (1): 18-23.
  • Woodfield GW, et al. (2007) TFAP2C controls hormone response in breast cancer cells through multiple pathways of estrogen signaling. Cancer Res. 67 (18): 8439-43.
  • Penna E, et al. (2011) microRNA-214 contributes to melanoma tumour progression through suppression of TFAP2C. EMBO J. 30 (10): 1990-2007.
  • Woodfield GW, et al. (2010) Identification of primary gene targets of TFAP2C in hormone responsive breast carcinoma cells. Genes Chromosomes Cancer. 49 (10): 948-62.
  • Size / Price
    Catalog: HG13115-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"