After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human DCUN1D1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DCUN1D1 cDNA Clone Product Information
Gene_bank_ref_id:BC009478
RefSeq ORF Size:780bp
cDNA Description:Full length Clone DNA of Homo sapiens DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) with C terminal Myc tag.
Gene Synonym:RP42, SCRO, Tes3, DCNL1, SCCRO, DCUN1L1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

DCUN1D1, also known as SCCRO, is part of an E3 ubiquitin ligase complex for neddylation. DCUN1D1 functions to recruit charged E2 and is involved in the release of inhibitory effects of CAND1 on cullin-RING ligase E3 complex assembly and activity. DCUN1D1 binds to the components of the neddylation pathway (Cullin-ROC1, Ubc12, and CAND1) and augments but is not required for cullin neddylation in reactions using purified recombinant proteins. DCUN1D1 also recruits Ubc12 approximately NEDD8 to the CAND1-Cul1-ROC1 complex but that this is not sufficient to dissociate or overcome the inhibitory effects of CAND1 on cullin neddylation in purified protein assays. DCUN1D1 also acts as am ncogene facilitating malignant transformation and carcinogenic progression.

References
  • Heir P. et al., 2013, Mol Cell Biol. 33 (8): 1621-31.
  • Kurz T. et al., 2005, Nature. 435 (7046): 1257-61.
  • Kim AY. et al., 2008, J Biol Chem. 283 (48): 33211-20.
  • Size / Price
    Catalog: HG15059-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"