Quick Order

Human AGO2 / EIF2C2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AGO2 cDNA Clone Product Information
Gene_bank_ref_id:NM_012154.2
RefSeq ORF Size:2580bp
cDNA Description:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2C, 2 with N terminal His tag.
Gene Synonym:Q10, AGO2, MGC3183, EIF2C2
Species:Human
Vector:pCMV3-N-His
Plasmid:pCMV3-His-AGO2
Restriction Site:HindIII + XbaI (6kb + 2.63kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human AGO2 Gene Plasmid Map
Human AGO2 / EIF2C2 ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Argonaute 2 (AGO2), also known as Eukaryotic translation initiation factor 2C2 (EIF2C2), belongs to the Argonaute family, AGO subfamily, which is a component of the RNA-induced silencing complex (RISC) and mediates small interfering RNA (siRNA)-directed mRNA cleavage and microRNA translational suppression. AGO2 protein is the catalytic engine of mammalian RNAi. It contains a PIWI domain that is structurally related to RNases H and possibly shares with them a two-metal-ion catalysis mechanism. Human AGO2 was unable to cleave preformed RNA duplexes and exhibited weaker binding affinity for RNA duplexes compared with the single strand RNA. The enzyme exhibited greater RNase H activity in the presence of Mn2+ compared with Mg2+. Human AGO2 exhibited weaker binding affinities and reduced cleavage activities for antisense RNAs with either a 5'-terminal hydroxyl or abasic nucleotide. In mouse hematopoiesis, AGO2 controls early development of lymphoid and erythroid cells. AGO2 is a highly specialized member of the Argonaute family with an essential nonredundant Slicer-independent function within the mammalian miRNA pathway. AGO2 regulates dFMR1 expression, and the relationship between dFMR1 and AGO2 was defined by their physical interaction and co-regulation of downstream targets. AGO2 and dFMR1 are also connected through a regulatory relationship. AGO2 is a regulator of dFMR1 expression and have clarified an important developmental role for AGO2 in the nervous system and germ line that requires dFMR1 function. In addition, AGO2 is regulated at both the transcriptional and posttranslational level, and also implicate AGO2 and enhanced micro-RNA activity in the tumorigenic progression of breast cancer cell lines.

References
  • O'Carroll D, et al. (2007) A Slicer-independent role for Argonaute 2 in hematopoiesis and the microRNA pathway. Genes Dev. 21(16): 1999-2004.
  • Pepper AS, et al. (2009) Argonaute2 suppresses Drosophila fragile X expression preventing neurogenesis and oogenesis defects. PLoS One. 4(10): e7618.
  • Lima WF, et al. (2009) Binding and cleavage specificities of human Argonaute2. J Biol Chem. 284(38): 26017-28.
  • Adams BD, et al. (2009) Argonaute-2 expression is regulated by epidermal growth factor receptor and mitogen-activated protein kinase signaling and correlates with a transformed phenotype in breast cancer cells. Endocrinology. 150(1): 14-23.
  • Salvatore V, et al. (2010) Bacterial expression of mouse argonaute 2 for functional and mutational studies. Int J Mol Sci. 11(2): 745-53.
  • Wilson JA, et al. (2011) Human Ago2 is required for efficient microRNA 122 regulation of hepatitis C virus RNA accumulation and translation. J Virol. 85(5): 2342-50.
  • Size / Price
    Catalog: HG11079-NH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"