Quick Order

Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BCL2cDNA Clone Product Information
cDNA Size:720
cDNA Description:ORF Clone of Homo sapiens B-cell CLL/lymphoma 2, nuclear gene encoding mitochondrial protein, transcript variant alpha DNA.
Gene Synonym:BCL2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10195-ACG$325
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10195-ACR$325
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10195-ANG$325
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10195-ANR$325
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10195-CF$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10195-CH$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10195-CM$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10195-CY$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone)HG10195-M$95
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10195-NF$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10195-NH$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10195-NM$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10195-NY$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10195-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

BCL2 (B-cell leukemia/lymphoma 2, N-Histidine-tagged), also known as Bcl-2, belongs to the Bcl-2 family. Bcl-2 family proteins regulate and contribute to programmed cell death or apoptosis. It is a large protein family and all members contain at least one of four BH (bcl-2 homology) domains. Certain members such as Bcl-2, Bcl-xl and Mcl1 are anti-apoptotic, whilst others are pro-apoptotic. Most Bcl-2 family members contain a C-terminal transmembrane domain that functions to target these proteins to the outer mitochondrial and other intracellular membranes. It is expressed in a variety of tissues. BCL2 blocks the apoptotic death of some cells such as lymphocytes. It also regulates cell death by controlling the mitochondrial membrane permeability and inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and/or by binding to the apoptosis-activating factor. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Two transcript variants, produced by alternate splicing, differ in their C-terminal ends.

  • Tsujimoto Y, et al. (1984) Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science. 226(4678):1097-99.
  • Cleary ML, et al. (1986) Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell. 47(1):19-28.
  • Otake Y, et al. (2007) Overexpression of nucleolin in chronic lymphocytic leukemia cells induces stabilization of Bcl-2 / Bcl-2 mRNA. Blood. 109(7):3069-75.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks