Quick Order

Human CD66e / CEACAM5 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CEACAM5 cDNA Clone Product Information
Gene_bank_ref_id:NM_004363.2
RefSeq ORF Size:2094bp
cDNA Description:Full length Clone DNA of Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 5 with N terminal His tag.
Gene Synonym:CEA, CD66e, DKFZp781M2392, CEACAM5
Species:Human
Vector:pCMV3-N-His
Plasmid:pCMV3-His-CEACAM5
Restriction Site:KpnI + XbaI (6kb + 2.14kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CEACAM5 Gene Plasmid Map
Human CD66e / CEACAM5 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

CEACAM5, also known as CEA or D66e, belongs to the large CEACAM subfamily of immunoglobulin superfamily. CEACAM5 is expressed primarily by epithelial cells, and is synthesized as a glycoprotein with a MW of 180 kDa comprising 60% carbohydrate. CEACAM5 contains one Ig-like V-type domain at the N-terminus, followed by six Ig-like C2-type domain and a GPI anchor, and exists as a homodimer. CEACAM5 and CEACAM6 are overexpressed in many cancers and are associated with adhesion and invasion. CEACAM5 can mediate cell-cell adhesion through homotypic and heterotypic interactions. It functions as a homotypic intercellular adhesion molecule and serves as a widely used tumor marker, since it is expressed at higher levels in tumorous tissues than in corresponding normal tissues. CEACAM5 has also been shown to contribute to tumorigenicity by inhibiting cellular differentiation. In addition, CEACAM5 is identified as the host receptor for the Dr family of adhesins of E.Coli, and the binding of E.coli Dr adhesins leads to dissociation of the CEACAM5 homodimer.

References
  • Baczyska D, et al. (2003) The tumorigenic potential of human CX-1 colon adenocarcinoma cells depends on carcinoembryonic antigen (CEACAM5) expression. Cell Mol Biol Lett. 8(2): 471-86.
  • Blumenthal RD, et al. (2005) Inhibition of adhesion, invasion, and metastasis by antibodies targeting CEACAM6 (NCA-90) and CEACAM5 (Carcinoembryonic Antigen). Cancer Res. 65(19): 8809-17.
  • Liebig B, et al. (2005) Forced expression of deltaN-TCF-1B in colon cancer derived cell lines is accompanied by the induction of CEACAM5/6 and mesothelin. Cancer Lett. 223(1): 159-67.
  • Size / Price
    Catalog: HG11077-NH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"