After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PADI4cDNA Clone Product Information
cDNA Size:1992
cDNA Description:ORF Clone of Homo sapiens peptidyl arginine deiminase, type I V DNA.
Gene Synonym:PAD, PAD4, PDI4, PDI5, PADI5, PADI4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11072-ACG$345
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11072-ACR$345
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11072-ANG$345
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11072-ANR$345
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11072-CF$315
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11072-CH$315
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11072-CM$315
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11072-CY$315
Human PADI4 Gene cDNA Clone (full-length ORF Clone)HG11072-M$115
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-taggedHG11072-M-M$315
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11072-M-N$315
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11072-NF$315
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11072-NH$315
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11072-NM$315
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11072-NY$315
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11072-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Protein-arginine deiminase type-4, also known as HL-60 PAD, Peptidylarginine deiminase IV, Protein-arginine deiminase type I V and PADI4, is a cytoplasm and nucleus protein which belongs to the protein arginine deiminase family. PADI4 is expressed in CD34+ stem cells in normal tissues, and many more CD34+ cells expressing PADI4 are present in tumour tissues. PADI4 post-translationally converts peptidylarginine to citrulline, a process called citrullination. Studies have demonstrated the high expression of PADI4 in various malignant tumour tissues. PADI4 is also expressed at high levels in the blood of patients with some malignant tumours. Citrullination of histone, cytokeratin, antithrombin and fibronectin have been confirmed to be involved in abnormal apoptosis, high coagulation, and disordered cell proliferation and differentiation, all of which are main features of malignant tumours. PADI4 may play an important role in tumourigenesis. Genetic variations in PADI4 are a cause of susceptibility to rheumatoid arthritis (RA). It is a systemic inflammatory disease with autoimmune features and a complex genetic component. It primarily affects the joints and is characterized by inflammatory changes in the synovial membranes and articular structures, widespread fibrinoid degeneration of the collagen fibers in mesenchymal tissues, and by atrophy and rarefaction of bony structures.

  • Nakashima K. et al.,1999, J. Biol. Chem. 274: 27786-92.
  • Suzuki A. et al., 2003, Nat. Genet. 34:395-402.
  • Nakayama-Hamada M. et al., 2005, Biochem. Biophys. Res. Commun. 327:192-200.
  • Chang, X. et al., 2010, Cancer Cell Int  10:7.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items