Quick Order

Text Size:AAA

Human SCARB1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SCARB1 cDNA Clone Product Information
NCBI RefSeq:NM_005505.4
RefSeq ORF Size:1529bp
cDNA Description:Full length Clone DNA of Homo sapiens scavenger receptor class B, member 1 with N terminal His tag.
Gene Synonym:CLA1, SRB1, CLA-1, SR-BI, CD36L1, MGC138242, SCARB1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Scavenger receptor class B, member 1 (SCARB1), also known as CD36L1, is a member of the scavenger receptor family. SCARB1 is expressed primarily in liver and non placental steroidogenic tissues, and predominantly localized to cholesterol and sphingomyelin-enriched domains within the plasma membrane. SCARB1 is proposed as a receptor for different ligands such as phospholipids, cholesterol ester, lipoproteins, phosphatidylserine and apoptotic cells, and is involved in a wide variety of physilogical processes. As a key component in the reverse cholesterol transport pathway, SCARB1 binds high density lipoproteins (HDLs) and mediates selective cholesterol uptake by a mechanism distinct from the LDL pathway. High density lipoproteins (HDLs) play a critical role in cholesterol metabolism and their plasma concentrations are inversely correlated with risk for atherosclerosis. SCARB1 may thus serve as a useful marker that predicts variation in baseline lipid levels and postprandial lipid response. The mouse SCARB1 has been shown to exert actions in determining the levels of plasma lipoprotein cholesterol and the accumulation of cholesterol stores in the adrenal gland.

References
  • Murao, K. et al., 1997, J. Biol. Chem. 272(28): 17551-17557.
  • Ikemoto, M. et al., 2000, Proc. Natl. Acad. Sci. U.S.A. 97 (12): 6538-6543.
  • Husemann, J. et al., 2001, Am. J. Pathol. 158 (3): 825-832. 
  • Williams, D.L. et al., 2001, Endocr. Res. 26 (4): 639-651.
  • Bulte, B. S. et al., 2002, J. Biol. Chem. 277 (39): 36092-36099.
  • Duncan, K.G. et al., 2002, Biochem. Biophys. Res. Commun. 292 (4): 1017-1022. 
  • Size / Price
    Catalog: HG11069-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"