After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human S100A4 cDNA Clone Product Information
Gene_bank_ref_id:NM_002961.2
RefSeq ORF Size:306bp
cDNA Description:Full length Clone DNA of Homo sapiens S100 calcium binding protein A4, transcript variant 1 with C terminal HA tag.
Gene Synonym:S100A4, 42A, 18A2, CAPL, FSP1, MTS1, P9KA, PEL98
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-HA tag on other vectors
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-GFPSpark tagHG10185-ACG$325
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10185-ACR$325
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, N-GFPSpark tagHG10185-ANG$325
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10185-ANR$325
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-Flag tagHG10185-CF$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-His tagHG10185-CH$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-Myc tagHG10185-CM$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, C-HA tagHG10185-CY$295
Human S100A4 transcript variant 1 Gene cDNA clone plasmidHG10185-M$95
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, Flag tagHG10185-M-F$295
Human S100A4 transcript variant 1 natural ORF mammalian expression plasmidHG10185-M-N$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, N-Flag tagHG10185-NF$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, N-His tagHG10185-NH$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, N-Myc tagHG10185-NM$295
Human S100A4 transcript variant 1 ORF mammalian expression plasmid, N-HA tagHG10185-NY$295
Human S100A4 transcript variant 1 natural ORF mammalian expression plasmidHG10185-UT$295
 Learn more about expression Vectors
Product nameProduct name
Background

S100A4, also known as metastasis-associated protein Mtsl, belongs to the family of small calcium-binding S100 proteins containing two EF-hand calcium-binding motifs. In humans at least 20 S100 family members that are distributed tissue specifically have been identified, and are involved in a number of cellular processes as transducers of calcium signal. S100A4 is a symmetric homodimer, and undergoes a relatively large conformational change upon the typical EF-hand binding calcium, which is necessary for S100A4 to interact with its protein targets and generate biological effects. It can bind the already known targets p53, F-actin, liprin β, myosin heavy chain II, and prevent their phosphorylation and multimerization. It has been demonstrated that S100A4 is directly involved in tumor metastasis including cell motility, invasion, apoptosis, angiogenesis and differentiation, and appears to be a metastasis factor and a molecular marker for clinical prognosis. Multiple alternatively spliced variants encoding the same protein have been identified.

References
  • Ambartsumian N. et al., 1995, Gene. 159: 125-30.
  • Marenholz I. et al., 2004, Biochem Biophys Res Commun. 322: 1111-22.
  • Helfman DM. et al., 2005, Br J Cancer. 92: 1955-8.
  • Saleem M. et al., 2006, Proc Natl Acad Sci. 103: 14825-30.
  • Boye K. et al., 2008, Int J Cancer. 123: 1301-10.
  • Garrett SC. et al., 2006, J Biol Chem. 281: 677-80.
  • Kriajevska M. et al., 2002, J Biol Chem. 277: 5299-335.
  • Size / Price
    Catalog: HG10185-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"