Quick Order

Text Size:AAA

Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TP53cDNA Clone Product Information
cDNA Size:1182
cDNA Description:ORF Clone of Homo sapiens tumor protein p53 (TP53), transcript variant 1 DNA.
Gene Synonym:TP53, p53, LFS1, TRP53, FLJ92943
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10182-ACG$325
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10182-ACR$325
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10182-ANG$325
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10182-ANR$325
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10182-CF$295
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10182-CH$295
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10182-CM$295
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10182-CY$295
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10182-G$95
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10182-G-N$295
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10182-NF$295
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10182-NH$295
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10182-NM$295
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10182-NY$295
Human P53 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10182-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

p53, also known as Tp53, is a DNA-binding protein which belongs to the p53 family. It contains transcription activation, DNA-binding, and oligomerization domains. p53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines, where it's believed to contribute to transformation and malignancy. p53 (TP53) is a transcription factor whose protein levels and post-translational modification state alter in response to cellular stress (such as DNA damage, hypoxia, spindle damage). Activation of p53 begins through a number of mechanisms including phosphorylation by ATM, ATR, Chk1 and MAPKs. MDM2 is a ubiquitn ligase that binds p53 and targets p53 for proteasomal degradation. Phosphorylation, p14ARF and USP7 prevent MDM2-p53 interactions, leading to an increase in stable p53 tetramers in the cytoplasm. Further modifications such as methylation and acetylation lead to an increase in Tp53 binding to gene specific response elements. Tp53 regulates a large number of genes (>100 genes) that control a number of key tumor suppressing functions such as cell cycle arrest, DNA repair, senescence and apoptosis. Whilst the activation of p53 often leads to apoptosis, p53 inactivation facilitates tumor progression. It is postulated to bind to a p53-binding site and activate expression of downstream genes that inhibit growth and/or invasion, and thus function as a tumor suppressor. Mutants of p53 that frequently occur in a number of different human cancers fail to bind the consensus DNA binding site, and hence cause the loss of tumor suppressor activity. Defects in TP53 are a cause of esophageal cancer, Li-Fraumeni syndrome, lung cancer and adrenocortical carcinoma.

  • Bakhrat A, et al. (2010) Drosophila Chk2 and p53 proteins induce stage-specific cell death independently during oogenesis. Apoptosis. 15(12):1425-34.
  • Kurzhals RL, et al. (2011) Chk2 and p53 are haploinsufficient with dependent and independent functions to eliminate cells after telomere loss. PLoS Genet. 7(6):e1002103.
  • Pardi N, et al. (2011) In vivo effects of abolishing the single canonical sumoylation site in the C-terminal region of Drosophila p53. Acta Biol Hung. 62(4):397-412.
  • Wells BS, et al. (2012) Maintenance of imaginal disc plasticity and regenerative potential in Drosophila by p53. Dev Biol. 361(2):263-76.