Quick Order

Rhesus GDF15 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus GDF15 cDNA Clone Product Information
Gene_bank_ref_id:XM_001114375.2
RefSeq ORF Size:927bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) growth differentiation factor 15 with N terminal HA tag.
Gene Synonym:GDF15
Species:Rhesus
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

Growth-differentiation factor 15 (GDF15), also known as MIC-1, is a secreted member of the transforming growth factor (TGF)-β superfamily, as a novel antihypertrophic regulatory factor in the heart. GDF-15 / GDF15 is not expressed in the normal adult heart but is induced in response to conditions that promote hypertrophy and dilated cardiomyopathy and it is expressed highly in liver. GDF-15 / GDF15 has a role in regulating inflammatory and apoptotic pathways in injured tissues and during disease processes. GDF-15 / GDF15 is synthesized as precursor molecules that are processed at a dibasic cleavage site to release C-terminal domains containing a characteristic motif of 7 conserved cysteines in the mature protein. GDF-15 / GDF15 overexpression arising from an expanded erythroid compartment contributes to iron overload in thalassemia syndromes by inhibiting hepcidin expression.

References
  • Ago T, et al. (2006) GDF15, a cardioprotective TGF-beta superfamily protein. Circ Res. 98 (3): 294-297.
  • Hsiao E, et al. (2000) Characterization of growth-differentiation factor 15, a transforming growth factor beta superfamily member induced following liver injury. Mol Cell Biol. 20 (10): 3742-51.
  • Zimmers T, et al. (2005) Growth differentiation factor-15/macrophage inhibitory cytokine-1 induction after kidney and lung injury. Shock. 23 (6): 543-8.
  • Size / Price
    Catalog: CG90069-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"