Quick Order

Text Size:AAA

Human PARP1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PARP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001618.3
RefSeq ORF Size:3045bp
cDNA Description:Full length Clone DNA of Homo sapiens poly (ADP-ribose) polymerase 1 with N terminal His tag.
Gene Synonym:PARP, PPOL, ADPRT, ADPRT1, PARP-1, pADPRT-1, PARP1
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Poly (ADP-ribose) polymerase 1(PRAP1), also known as NAD(+) ADP-ribosyltransferase 1(ADPRT), is a chromatin-associated enzyme which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The ADP-D-ribosyl group of NAD+ is transferred to an acceptor carboxyl group on a histone or the enzyme itself, and further ADP-ribosyl groups are transferred to the 2'-position of the terminal adenosine moiety, building up a polymer with an average chain length of 20-30 units. The poly(ADP-ribosyl)ation modification is critical for a wide range of processes, including DNA repair, regulation of chromosome structure, transcriptional regulation, mitosis and apoptosis. PARP1 is demonstrateed to mediate the poly(ADP-ribose) ation of APLF (aprataxin PNK-like factor) and CHFR (checkpoint protein with FHA and RING domains), two representative proteins involved in the DNA damage response and checkpoint regulation. Further, It has been suggested that DNA-dependent protein kinase (DNA-PK), another component of DNA repair, suppresses PARP activity, probably through direct binding and/or sequestration of DNA-ends which serve as an important stimulator for both enzymes. PARP1 inhibitors is thus proposed as a targeted cancer therapy for recombination deficient cancers, such as BRCA2 tumors.

References
  • Malanga M. et al., 1998, J Biol Chem. 273: 11839-11843.
  • Ariumi Y. et al., 1999, Oncogene. 18: 4616-4625.
  • Helleday T. et al., 2005, Cell Cycle. 4: 1176-1178.
  • Ahell I. et al., 2008, Nature. 451: 81-85.
  • Size / Price
    Catalog: HG11040-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"