Quick Order

Text Size:AAA

Human PROM1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
PROM1cDNA Clone Product Information
Gene Bank Ref.ID:BC012089
cDNA Size:2571
cDNA Description:ORF Clone of Homo sapiens prominin 1 DNA.
Gene Synonym:RP41, AC133, CD133, MCDR2, STGD4, CORD12, PROML1, MSTP061
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

CD133, also known as PROM1 and Prominin 1, is a pentaspan transmembrane glycoprotein which belongs to the prominin family. It localizes to membrane protrusions and is often expressed on adult stem cells. CD133 is known to play a role in maintaining stem cell properties by suppressing differentiation. CD133 binds cholesterol in cholesterol-containing plasma membrane microdomains. It is proposed to play a role in apical plasma membrane organization of epithelial cells. CD133 is also involved in regulation of MAPK and Akt signaling pathways. Mutations in PROM1 gene have been shown to result in retinitis pigmentosa and Stargardt disease. PROM1 gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Expression of this gene is also associated with several types of cancer.

  • Corbeil D. et al., 2001, Biochem Biophys Res Commun. 285 (4): 939-44.
  • Horn PA. et al., 1999, Blood. 93 (4): 1435-37.
  • Sanai N. et al., 2005, N Engl J Med. 353 (8): 811-22.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availsability:2-3 weeks