Quick Order

Text Size:AAA

Cynomolgus monkey HFE2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus HFE2 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:1284bp
cDNA Description:Full length Clone DNA of Macaca mulatta hemochromatosis type 2 (juvenile) with N terminal HA tag.
Gene Synonym:HFE2
Species:Cynomolgus
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Hemojuvelin, also known as HFE2, is a membrane-bound and soluble protein which belongs to the repulsive guidance molecule (RGM) family. It is known that RGMs function through Neogenin, a homologue of the Netrin receptor deleted in colon cancer. In mammals, RGM family consists of three glycoproteins which have discrete expression patterns and functions (RGM-A, RGM-B, and RGM-C). Hemojuvelin is expressed in adult and fetal liver, heart, and skeletal muscle. Hemojuvelin acts as a bone morphogenetic protein (BMP) coreceptor. Enhancement of BMP signaling regulates hepcidin (HAMP) expression and iron metabolism. It plays a key role in iron metabolism. Hemojuvelin represents the cellular receptor for hepcidin. It may be a component of the signaling pathway which activates hepcidin or it may act as a modulator of hepcidin expression. Defects in hemojuvelin are the cause of hemochromatosis type 2A, also known as juvenile hemochromatosis (JH).

References
  • Papanikolaou G, et al. (2004) Mutations in HFE2 cause iron overload in chromosome 1q-linked juvenile hemochromatosis. Nat Genet. 36(1):77-82.
  • Babitt JL, et al. (2006) Bone morphogenetic protein signaling by hemojuvelin regulates hepcidin expression. Nat Genet. 38(5):531-9.
  • Zhang AS, et al. (2008) Neogenin-mediated hemojuvelin shedding occurs after hemojuvelin traffics to the plasma membrane. J Biol Chem. 283(25):17494-502.
  • Size / Price
    Catalog: CG90061-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"