Quick Order

Text Size:AAA

Human CD8B transcript variant 1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD8B cDNA Clone Product Information
Gene_bank_ref_id:NM_172099.2
RefSeq ORF Size:633bp
cDNA Description:Full length Clone DNA of Homo sapiens CD8b molecule, transcript variant 1 with N terminal His tag.
Gene Synonym:Ly3, LYT3, Leu2, CD8B1, MGC119115
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

CD8B (CD8b molecule), also known as P37 and LEU2, contains 1 Ig-like V-type (immunoglobulin-like) domain. The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen, acting as a coreceptor, and the T-cell receptor on the T lymphocyte recognize antigens displayed by an antigen presenting cell (APC) in the context of class I MHC molecules. The functional coreceptor is either a homodimer composed of two alpha chains, or a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. P37 gene encodes the CD8 beta chain isoforms. Multiple alternatively spliced transcript variants encoding distinct membrane associated or secreted isoforms have been described. A pseudogene, also located on chromosome 2, has been identified. CD8 is thought to play a role in the process of T-cell mediated killing.

References
  • Leahy DJ, et al. (1992) Crystal structure of a soluble form of the human T cell coreceptor CD8 at 2.6 A resolution. Cell. 68(6):1145-62.
  • Gao G, et al. (2000) Molecular interactions of coreceptor CD8 and MHC class I: the molecular basis for functional coordination with the T-cell receptor. Immunol Today. 21(12):630-6.
  • Devine L, et al. (1999) Orientation of the Ig domains of CD8 alpha beta relative to MHC class I. J Immunol. 162(2):846-51.
  • Size / Price
    Catalog: HG11031-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"