Quick Order

Human ATP1B4 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ATP1B4 cDNA Clone Product Information
Gene_bank_ref_id:NM_001142447.2
RefSeq ORF Size:1074bp
cDNA Description:Full length Clone DNA of Homo sapiens ATPase, Na+/K+ transporting, beta 4 polypeptide with C terminal His tag.
Gene Synonym:ATP1B4
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

ATP1B4 is a member of the X(+)/potassium ATPases subunit beta family. It is highly expressed in skeletal muscle and at a lower level in heart. ATP1B4 gene can be found in all vertebrate genomes sequenced to date. However, this gene has undergone a change in function in placental mammals compared to other species. Specifically, in fish, avian, and amphibian species, this gene encodes plasma membrane-bound beta-subunits of Na, K-ATPase. In placental mammals, the encoded protein interacts with the nuclear transcriptional coregulator SKIP and may be involved in the regulation of TGF-beta signaling. ATP1B4 may act as a transcriptional coregulator during muscle development through its interaction with SNW1. Na+, K+-ATPase is an important regulator of intracellular electrolyte levels in most mammalian cells. It is a Mg2+-dependent transport pump responsible for maintaining the low intracellular Na+:K+ ratio that is essential for cell homeostasis and physiological function. It catalyzes the active uptake of K+ and extrusion of Na+ at the expense of hydrolyzing ATP with a stoichiometry of 3 Na+ for 2 K+. ATP1B4 has lost its ancestral function as a Na,K-ATPase beta-subunit.

References
  • Pestov NB. et al., 2007, Proc Natl Acad Sci. 104 (27): 11215-20.
  • Kung AW. et al., 2006, Clin Endocrinol. 64 (2): 158-61.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Catalog: HG13027-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"