Quick Order

Human ITGA2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ITGA2 cDNA Clone Product Information
Gene_bank_ref_id:NM_002203.3
RefSeq ORF Size:3546bp
cDNA Description:Full length Clone DNA of Homo sapiens integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) with C terminal His tag.
Gene Synonym:BR, GPIa, CD49B, VLA-2, VLAA2, ITGA2
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-ITGA2-His
Restriction Site:KpnI + XbaI (6kb + 3.59kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 759 C/T, 825 G/A and 3252 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catalog: HG13024-CH
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"