Quick Order

Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSNK2A2cDNA Clone Product Information
Gene_bank_ref_id:NM_001896.2
cDNA Size:1053
cDNA Description:ORF Clone of Homo sapiens casein kinase 2, alpha prime polypeptide DNA.
Gene Synonym:CK2A2, CSNK2A1, FLJ43934
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11018-ACG$325
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11018-ACR$325
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11018-ANG$325
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11018-ANR$325
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11018-CF$295
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11018-CH$295
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11018-CM$295
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11018-CY$295
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone)HG11018-M$95
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG11018-M-F$295
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG11018-M-N$295
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11018-NF$295
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11018-NH$295
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11018-NM$295
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11018-NY$295
Human CSNK2A2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11018-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Casein kinase II subunit alpha', also known as CSNK2A2 and CK2A2, is a member of the protein kinase superfamily, Ser/Thr protein kinase family and CK2 subfamily. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. The alpha and alpha' chains contain the catalytic site. CSNK2A2 is a tetramer composed of an alpha chain, an alpha' and two beta chains. It is also component of a CK2-SPT16-SSRP1 complex composed of SSRP1, SUPT16H, CSNK2A1, CSNK2A2 and CSNK2B, the complex associating following UV irradiation. Protein kinase casein kinase II (Ck2) is a cyclic-AMP and calcium-independent serine-threonine kinase that is composed of two catalytic subunits (alpha and alpha') and two regulatory beta-subunits. Ck2 is not a casein kinase in vivo, but over 100 substrates are known. The highly conserved amino acid sequences of its subunits and their broad expression suggest that Ck2 may have a fundamental role in cell function. Ck2 has been implicated in DNA replication, regulation of basal and inducible transcription, translation and control of metabolism. The Ck2alpha and Ck2alpha' isoforms (products of the genes Csnk2a1 and Csnk2a2, respectively) are highly homologous, the reason for their redundancy and evolutionary conservation is unknown. CSNK2A2 may be a candidate gene for these inherited syndromes.

References
  • Xu X. et al., 1999, Nat Genet. 23 (1):118-21.
  • Aasland M. et al., 2000, Anim Genet. 31 (2):131-4.
  • Escalier D. et al., 2003, Mol Reprod Dev. 66 (2):190-201.
  • Ackermann K. et al., 2005, Mol Cell Biochem. 274 (1-2):91-101.
  • Size / Price
    Catalog:HG11018-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"