Quick Order

Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HK3cDNA Clone Product Information
cDNA Size:2772
cDNA Description:ORF Clone of Homo sapiens hexokinase 3 (white cell) DNA.
Gene Synonym:HXK3, HKIII
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11016-ACG$425
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11016-ACR$425
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11016-ANG$425
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11016-ANR$425
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11016-CF$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11016-CH$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11016-CM$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11016-CY$395
Human HK3 Gene cDNA Clone (full-length ORF Clone)HG11016-M$145
Human HK3 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG11016-M-F$395
Human HK3 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG11016-M-N$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11016-NF$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11016-NH$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11016-NM$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11016-NY$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11016-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name

Hexokinase-3, also known as Hexokinase type III, HKIII and HK3, is a protein which belongs to the hexokinase family. Hexokinase-3 / HK3 is an enzyme which in humans is encoded by the HK2 gene. Hexokinases phosphorylate glucose to produce glucose 6-phosphate, committing glucose to the glycolytic pathway. In mammalian tissues hexokinase exists as four isoenzymes encoded by distinct genes. These proteins are homologous and are organized in two homologous domains, with the exception of hexokinase type IV which has only one. This organization is believed to be the result of a duplication and tandem fusion event involving the gene encoding for the ancestral hexokinase. The gene encodes hexokinase-3. Similar to hexokinases-1 and hexokinases-2, this allosteric enzyme is inhibited by its product glucose 6-phosphate.

  • Palma F. et al., 1996, Mol Cell Biochem. 155: 23-9.
  • Furuta H. et al.,1996, Genomics. 36 (1): 206-9.
  • Colosimo A. et al.,1996, Cytogenet Cell Genet. 74 (3): 187-8.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items