Quick Order

Text Size:AAA

Human MID1IP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MID1IP1cDNA Clone Product Information
Gene_bank_ref_id:BC008908
cDNA Size:552
cDNA Description:ORF Clone of Homo sapiens MID1 interacting protein 1 DNA.
Gene Synonym:S14R, MIG12, THRSPL, G12-like, STRAIT11499, MID1IP1
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human MID1IP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name
Background

MID1IP1 belongs to the SPOT14 family. It is a homodimer in the absence of THRSP. MID1IP1 interacts with ACACA and ACACB. It plays a role in the regulation of lipogenesis in liver. It up-regulates ACACA enzyme activity. MID1IP1 is required for efficient lipid biosynthesis, including triacylglycerol, diacylglycerol and phospholipid. MID1IP1 is involved in stabilization of microtubules. Its interaction with THRSP interferes with ACACA binding.

References
  • Aipoalani DL. et al., 2010, Endocrinology. 151 (5): 2071-7.
  • Colbert CL. et al., 2010, Proc Natl Acad Sci. 107 (44): 18820-5.
  • Inoue J. et al., 2011, Mol Endocrinol. 25 (6): 995-1005.
  • Size / Price
    Catalog:HG14005-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"