Quick Order

Text Size:AAA

Rhesus TGFB2 ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus TGFB2 cDNA Clone Product Information
NCBI RefSeq:XM_001103911.2
RefSeq ORF Size:1245bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) transforming growth factor, beta 2 with N terminal HA tag.
Gene Synonym:Img, LIG-1, D6Bwg0781e, Lrig1
Species:Rhesus
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Human TGFB1 (LAP) / TGF-beta 1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman ALK-2 / ACVR1 Protein (His & Fc Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human TGFBR2 Protein (His & Fc Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human ALK4 / ACVR1B Protein (His Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human BAMBI / NMA Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Human ATF2 Protein (His & GST Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinRat Cripto / TDGF1 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Rhesus ACVR1B / ALK-4 Protein (Fc Tag)Mouse BAMBI / NMA Protein (Fc Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rhesus TGFBR2 Protein (Fc Tag)Rhesus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Mouse Smad5 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)
Background

TGF beta 2 (Transforming growth factor beta 2), an extracellular glycosylated protein, which belongs to the TGF-beta family. TGF-beta regulates key mechanisms of tumor development, namely immunosuppression, metastasis, angiogenesis, and proliferation. TGF beta 2 suppression is a promising therapeutic approach for malignant tumor therapy. The signaling pathway of TGF beta 2/Smad plays an important role in the pathological process in posterior capsule opacification (PCO) after cataract surgery. Silencing Smad2 and Smad3 efficiently blocked the effect of TGF beta 2 on cell proliferation, migration, and extracellular matrix production. TGF beta 2 activation of MEKK3/ERK1/2/5 signaling modulates Has2 expression and hyaluronan (HA) production leading to the induction of epithelial to mesenchymal transformation (EMT) events. In addition, the upregulation of the TGF beta 2 level is a common pathological feature of Alzheimer's disease (AD) brains and suggests that it may be closely linked to the development of neuronal death related to AD.

References
  • Schlingensiepen KH, et al. (2006) Targeted tumor therapy with the TGF-beta 2 antisense compound AP 12009. Cytokine Growth Factor Rev. 17(1-2): 129-39.
  • Ghatpande SK, et al. (2010) Transforming growth factor beta2 is negatively regulated by endogenous retinoic acid during early heart morphogenesis. Dev Growth Differ. 52(5): 433-55.
  • Noguchi A, et al. (2010) Transforming growth factor beta2 level is elevated in neurons of Alzheimer's disease brains. Int J Neurosci. 120(3): 168-75.
  • Li J, et al. (2011) Comparative effects of TGF-_2/Smad2 and TGF-_2/Smad3 signaling pathways on proliferation, migration, and extracellular matrix production in a human lens cell line. Exp Eye Res. 92(3): 173-9.
  • Size / Price
    Catalog: CG90036-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"