Quick Order

Human RPS6KA6 / RSK4 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RPS6KA6 cDNA Clone Product Information
Gene_bank_ref_id:NM_014496.2
RefSeq ORF Size:2238bp
cDNA Description:Full length Clone DNA of Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 6 (RPS6KA6) with C terminal HA tag.
Gene Synonym:RPS6KA6, RSK4
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Ribosomal protein S6 kinase alpha-6, also known as Ribosomal S6 kinase 4, 90 kDa ribosomal protein S6 kinase 6,RSK-4, RSK4 and RPS6KA6, is a protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and S6 kinase subfamily. RPS6KA6 contains one AGC-kinase C-terminal domain and two protein kinase domains. RPS6KA6 forms a complex with either ERK1 or ERK2 in quiescent cells. RPS6KA6 shows a high level of homology to three isolated members of the human RSK family. RSK2 is involved in Coffin-Lowry syndrome and nonspecific MRX. The localization of RPS6KA6 in the interval that is commonly deleted in mentally retarded males together with the high degree of amino acid identity with RSK2 suggests that RPS6KA6 plays a role in normal neuronal development. Further mutation analyses in males with X-linked mental retardation must prove that the gene of RPS6KA6 is indeed a novel MRX gene. RPS6KA6 is a serine/threonine kinase that may play a role in mediating the growth-factor and stress induced activation of the transcription factor CREB. RPS6KA6 is activated by multiple phosphorylations on threonine and serine residues.

Size / Price
Catalog: HG10147-CY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"