After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CCNA1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCNA1 cDNA Clone Product Information
Gene_bank_ref_id:NM_003914.3
RefSeq ORF Size:1398bp
cDNA Description:Full length Clone DNA of Homo sapiens cyclin A1 with N terminal His tag.
Gene Synonym:CCNA1
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Cyclin A1 is a member of the highly conserved cyclin family that is characterized by a dramatic periodicity in protein abundance, and belongs to the A-type cyclin subfamily. The mammalian A-type cyclin family consists of two members: cyclin A1 and cyclin A2. Different cyclins exhibit distinct expression. Cyclin A1 is expressed in mice exclusively in the germ cell lineage and high rate of cyclinA1 is found in human testis and certain myeloid leukaemia cells. Cyclin A1 is primarily function in the control of meiosis. It serves as regulator subunits binding to cyclin-dependent kinase 1 (Cdk1) and cyclin-dependent kinase 2 (Cdk2), which give two different kinase activities, one appearing in S phase, the other in G2. Through this, cyclin A1 operate the entry and progression in cell cycle. High frequency of cyclin A1 overexpression has been observed in acute myelocytic leukemias, especially those that are at the promyelocyte and myeloblast stages of development.

References
  • Yang R, et al. (1999) Functions of Cyclin A1 in the cell cycle and its interactions with transcription factor E2F-1 and the Rb family of proteins. Molecular and Cellular biology. 19 (3): 2400-7.
  • Yang R, et al. (1999) Cyclin A1 expression in leukemia and normal hematopoietic cells. Blood. 93 (6): 2067-74.
  • Size / Price
    Catalog: HG11013-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"