Quick Order

Text Size:AAA

Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TNNC1cDNA Clone Product Information
cDNA Size:486
cDNA Description:ORF Clone of Homo sapiens troponin C type 1 (slow) DNA.
Gene Synonym:TNC, TNNC, CMD1Z
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11011-ACG$325
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11011-ACR$325
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11011-ANG$325
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11011-ANR$325
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11011-CF$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11011-CH$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11011-CM$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11011-CY$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone)HG11011-M$95
Human TNNC1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG11011-M-F$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG11011-M-N$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11011-NF$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11011-NH$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11011-NM$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11011-NY$295
Human TNNC1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11011-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Troponin I, also known as TNNC1, is part of the troponin complex. This complex contains 3 subunits: troponin I (TnI), troponin T (TnT) and troponin C (TnC). Troponin I is the inhibitory subunit, blocking actin-myosin interactions and thereby mediating striated muscle relaxation. It binds to actin in thin myofilaments to hold the actin-tropomyosin complex in place. Because of it myosin cannot bind actin in relaxed muscle. When calcium binds to the Troponin C it causes conformational changes which lead to dislocation of troponin I and finally tropomyosin leaves the binding site for myosin on actin leading to contraction of muscle.

  • Kalaji FR. et al., 2012, Saudi J Kidney Dis Transpl. 23 (5): 939-45.
  • Wijnker PJ. et al., 2013, Am J Physiol Heart Circ Physiol. 304 (2): H260-8.
  • Solaro RJ. et al., 2013, Circ Res. 112 (2): 355-66.