After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human MMGT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MMGT1cDNA Clone Product Information
cDNA Size:396
cDNA Description:ORF Clone of Homo sapiens membrane magnesium transporter 1 DNA.
Gene Synonym:EMC5, TMEM32, MMGT1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

MMGT1, also known as EMC5, is comparable with primary microglial cells with respect to morphology, presence of acetylated low density lipoprotein receptor, non-specific esterase, CD63, major histocompatibility complex antigens and CD11, and binding for Ricinus communis agglutinin. Primary microglia as well as MMGT1 cells are negative for glial fibrillary acidic protein. Different MMGT1 strains are obtained after subcloning, two of which resembled histiocytes (F4/80 and BM-8). These cell strains, MMGT12 and 16, are able to opsonize latex beads, and could be induced by endotoxins (LPS) to secrete TNF-alpha, IL-1, IL-6, TGF-beta, and EGF.

  • Goytain A. et al., 2008, Am J Physiol Cell Physiol. 294 (2): C495-502.
  • Briers TW. et al., 1994, J Neuroimmunol. 52 (2): 153-64.
  • Jäger S. et al., 2011, Nature. 481 (7381): 365-70.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items