After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TMEFF2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TMEFF2cDNA Clone Product Information
Gene_bank_ref_id:NM_016192.2
cDNA Size:1125
cDNA Description:ORF Clone of Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 2 DNA.
Gene Synonym:TR, HPP1, TPEF, TENB2, TMEFF2
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Epidermal Growth Factor (EGF) & Receptor Related Products
Product nameProduct name
Canine NRG1-alpha Protein (ECD, Fc Tag)Human TGFA / TGF-alpha ProteinHuman NRG1 Protein (His Tag, ECD)Canine NRG1-alpha Protein (ECD)Mouse EGFL6 / EGF-L6 Protein (His Tag)Mouse EGFL6 / EGF-L6 Protein (Fc Tag)Human TMEFF1 / Tomoregulin-1 Protein (Fc Tag, ECD)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinMouse EGF / Epidermal growth factor Protein (His Tag)Rhesus HER3 / ErbB3 ProteinHuman HER3 / ErbB3 ProteinRhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Cynomolgus / Rhesus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Human NRG1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human HBEGF / DTR ProteinHuman / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human EGF / Epidermal Growth Factor Protein (Fc Tag)Human EGF / Epidermal Growth Factor ProteinHuman Epiregulin / EREG Protein (Fc Tag) Human EGFL6 / EGF-L6 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (His Tag)Human NRG1-beta 1 Protein (EGF Domain, Fc Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG4 ProteinHuman BTC / Betacellulin Protein (Fc Tag)Human BTC / Betacellulin ProteinHuman NRG1-alpha Protein (EGF Domain, Fc Tag)Human NRG1-alpha Protein (ECD, Fc Tag)Human NRG1-alpha Protein (ECD, His Tag)Mouse BTC / Betacellulin Protein (His & Fc Tag)Mouse EGFL7 / VE-statin Protein (His Tag)Mouse EGF / Epidermal Growth Factor Protein (Fc Tag)Mouse EGF / Epidermal Growth Factor ProteinMouse EGF / Epidermal Growth Factor ProteinMouse LRIG1 / LIG-1 Protein (His Tag)Mouse Epiregulin / EREG Protein (Fc Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Canine HER2 / ErbB2 Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Mouse HER4 / ErbB4 Protein (His Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Canine EGF / Epidermal Growth Facto Protein (His Tag)Rat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rat HER2 / ErbB2 ProteinRat EGFR / HER1 / ErbB1 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Cynomolgus BTC / Betacellulin Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Mouse TMEFF1 / Tomoregulin-1 Protein (Fc Tag)Rat EGF / Epidermal Growth Factor ProteinCanine NRG1 Protein (His Tag)Rat HER4 / ErbB4 Protein (His Tag)Canine NRG1-alpha Protein (EGF Domain, Fc Tag)Canine NRG1-alpha Protein (ECD, His Tag)
Size / Price
Catalog:HG11006-NH
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"