Quick Order

Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
L1CAMcDNA Clone Product Information
Gene_bank_ref_id:NM_024003.2
cDNA Size:3804
cDNA Description:ORF Clone of Homo sapiens L1 cell adhesion molecule (L1CAM), transcript variant 2 DNA.
Gene Synonym:L1CAM, S10, HSAS, MASA, MIC5, SPG1, CAML1, CD171, HSAS1, N-CAML1
Species:Human
Vector:pCMV3-C-HA
Restriction Site:HindIII + XbaI
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1977 T>C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10140-ACG$475
Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10140-ACR$475
Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10140-CF$445
Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10140-CH$445
Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10140-CM$445
Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10140-CY$445
Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)HG10140-G$195
Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10140-NF$445
Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10140-NH$445
Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10140-NM$445
Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10140-NY$445
Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10140-UT$445
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

L1 cell adhesion molecule (L1CAM), also designated as CD171, is a cell adhesion receptor of the immunoglobulin superfamily, known for its roles in nerve cell function. While originally believed to be present only in brain cells, in recent years L1-CAM has been detected in other tissues, and in a variety of cancer cells, including some common types of human cancer. L1CAM interacts with a variety of ligands including axonin-1, CD9, neurocan and intergrins, and it has been revealed that the RGD motif in the sixth Ig domain of L1CAM is a binding site for integrins, thus important for nuclear signaling. Disruption of L1CAM function causes three X-linked neurological syndromes, i.e. hydrocephalus, MASA syndrome (mental retardation, aphasia, shuffling gait and adducted thumbs) and spastic paraplegia syndrome. Overexpression of L1CAM in normal and cancer cells increased motility, enhanced growth rate and promoted cell transformation and tumorigenicity. Recent work has identified L1CAM (CD171) as a novel marker for human carcinoma progression, and a candidate for anti-cancer therapy.

References
  • Meier F, et al. (2006) The adhesion molecule L1 (CD171) promotes melanoma progression. Int J Cancer. 119(3): 549-55.
  • Gavert N, et al. (2008) L1-CAM in cancerous tissues. Expert Opin Biol Ther. 8(11): 1749-57.
  • Issa Y, et al. (2009) Enhanced L1CAM expression on pancreatic tumor endothelium mediates selective tumor cell transmigration. J Mol Med. 87(1): 99-112.
  • Weidle UH, et al. (2009) L1-CAM as a target for treatment of cancer with monoclonal antibodies. Anticancer Res. 29(12): 4919-31.
  • Raveh S, et al. (2009) L1 cell adhesion molecule (L1CAM) in invasive tumors. Cancer Lett. 282(2): 137-45.
  • Wolterink S, et al. (2010) Therapeutic antibodies to human L1CAM: functional characterization and application in a mouse model for ovarian carcinoma. Cancer Res. 70(6): 2504-15.
  • Size / Price
    Catalog:HG10140-CY
    List Price: $445.00  (Save $0.00)
    Price:$445.00      [How to order]
    Availability5 business days
    Images
    • Human CD171 / NCAM-L1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"